View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5194-Insertion-7 (Length: 158)
Name: NF5194-Insertion-7
Description: NF5194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5194-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 31980552 - 31980402
Alignment:
| Q |
8 |
tttttcataccttcaacatcatcatgtcaagccctaattccagatcattgaactggcactacactgagcttgatgatagagacctagaaatcaaaggcag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980552 |
tttttcataccttcaacatcatcatgtcaagccctaattccagatcattgaactggcactacactgagcttgatgatagagacctagaaatcaaaggcag |
31980453 |
T |
|
| Q |
108 |
aacacttttcttcgttattgtactcttctcaattttccttcttgttatcgt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980452 |
aacacttttcttcgttattgtactcttctcaattttccttcttgttatcgt |
31980402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University