View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5195_low_3 (Length: 435)
Name: NF5195_low_3
Description: NF5195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5195_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 11 - 415
Target Start/End: Original strand, 36964310 - 36964742
Alignment:
| Q |
11 |
cagagatacaaatggactttcaagattcttaaatggtaatcaacattgtcttgtatatgatgtgaata------tgatcatgtatatgagtattcatgca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36964310 |
cagagatacaaatggactttcaagattcttaaatggtaatcaacattgtcttgtatatgatgtgaataataatatgatcatgtatatgagtattcatgca |
36964409 |
T |
 |
| Q |
105 |
ttaatgatgtgacaactcagaacagcagccactgatcaacact---------gttgtagtcacggtttgccttggggtctcaattttttatattgtagag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36964410 |
ttaatgatgtgacaactcagaacagcagccactgatcaacactttcaacactgttgtagtcacggtttgccttggggtcgcaattttttatattgtagag |
36964509 |
T |
 |
| Q |
196 |
aattacgtt------------aataggctagctttaattctttatattagagaaatgcaaaggaaaaacatgtattgatgaggtctatttttcttttgtt |
283 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36964510 |
aattacgttcagtgtggcattaataggctagctttaattctttatattagagaaatgcaaaggaaaaacatgtattgatgaggtctatttttcttttgtt |
36964609 |
T |
 |
| Q |
284 |
ttgctgctaccgattttgggtccaggatcaaccattggccgggtttttatcttcagtgaagtctgtggaggatcattctgttcaagttgaacctgctaaa |
383 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36964610 |
ttgctgctaccaattttgggtccaggatcaaccattggccgggtttttatcttcagtgaagtctgtggaggatcattctgttcaagttgaacctgctaaa |
36964709 |
T |
 |
| Q |
384 |
gcagcaactttagatatatt-attgggaagaaa |
415 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
36964710 |
gcagcaactttagatatattgattgggaagaaa |
36964742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University