View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5196-Insertion-9 (Length: 102)
Name: NF5196-Insertion-9
Description: NF5196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5196-Insertion-9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 4e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 4e-29
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 35628634 - 35628545
Alignment:
| Q |
8 |
atttcttcaacaagctgcagcgaccacctttctgggttttaccaaatttccaatgggattgattagtggtttaacttggattattttgatttgt |
101 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35628634 |
atttcttcaacaagcagcagccaccacctttctgggttttaccgaatttccaatgg----gattagtggtttaacttggattattttgatttgt |
35628545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University