View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5196_low_11 (Length: 242)
Name: NF5196_low_11
Description: NF5196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5196_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 6352340 - 6352552
Alignment:
| Q |
13 |
gaaatgaagcatgtatagctatagcaatttgcaacctaattatacaccccattggtagcttttagtatttt-ccataatatcttttgcatgtcctactac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6352340 |
gaaaagaagcatgtatagctatagcaatttgcaacctaattatacaccccattggttgcttttagtattttaccataatatcttttgcatgtcctactac |
6352439 |
T |
|
| Q |
112 |
caactattcatggtagaggtagaattgaaacatggccacttgtcattttaatgctatataaaatgacagcttcaaaattaggcccccacatgaataaaag |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6352440 |
caactattcacggtagaggtagaattgaaacatggccacttgtcattttaatgctctataaaatgacagcttcaaaattaggcccccacatgaagaaaag |
6352539 |
T |
|
| Q |
212 |
atacgggtagctt |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6352540 |
atacgggtagctt |
6352552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University