View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5196_low_7 (Length: 304)
Name: NF5196_low_7
Description: NF5196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5196_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 142 - 297
Target Start/End: Original strand, 48157317 - 48157472
Alignment:
| Q |
142 |
tggatgagattaaggtcttgtcttggtgttggactttggatagattgttgaagcagccgtgtttgtattacgagtggtgctggaacccaaaggaatgttt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48157317 |
tggatgagattaaggtcttgtcttggtgttggactttggatagattgttgaagcagccgtgtttgtattacgagtggtgctggaactcaaaggaatgttt |
48157416 |
T |
|
| Q |
242 |
atcaagataatgggggcttgtctagtttgggcccctttgttttgtgctgctctctg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48157417 |
atcaagataatgggggcttgtctagtttgggcccctttgttttgtgctgctgtctg |
48157472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 48156808 - 48156941
Alignment:
| Q |
16 |
agcttcttcacaatcgagttccaactaggatggaccttgcggagaggcatgcgacgatttgggttttatggagagcaaggaacaatagagttttcaataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
48156808 |
agcttcttcacaatcgagttccaactaggatgaaccttgcggagaggcatgcgacgatttgagttttatggaaagcaaggagcaatagagttttcaataa |
48156907 |
T |
|
| Q |
116 |
cttgcatatggaggcgtgagagttggtggatgag |
149 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
48156908 |
cttgcatatggaggcgggagagttggtggatgag |
48156941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 61 - 97
Target Start/End: Original strand, 47820183 - 47820219
Alignment:
| Q |
61 |
ggcatgcgacgatttgggttttatggagagcaaggaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
47820183 |
ggcatgcgacgatttgggttttatggaaagctaggaa |
47820219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 253
Target Start/End: Original strand, 6232239 - 6232285
Alignment:
| Q |
207 |
tattacgagtggtgctggaacccaaaggaatgtttatcaagataatg |
253 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||| |||||||| |
|
|
| T |
6232239 |
tattacgagtggtgctggaaccccaaggaatgcttattgagataatg |
6232285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 243
Target Start/End: Complemental strand, 19883539 - 19883503
Alignment:
| Q |
207 |
tattacgagtggtgctggaacccaaaggaatgtttat |
243 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
19883539 |
tattacgagtggtgttggaaccccaaggaatgtttat |
19883503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 243
Target Start/End: Complemental strand, 380737 - 380701
Alignment:
| Q |
207 |
tattacgagtggtgctggaacccaaaggaatgtttat |
243 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
380737 |
tattacgagtggtgctggaaccccaaggaatgcttat |
380701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University