View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5197-Insertion-3 (Length: 115)
Name: NF5197-Insertion-3
Description: NF5197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5197-Insertion-3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0790 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 7e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 7e-22
Query Start/End: Original strand, 63 - 115
Target Start/End: Complemental strand, 24428513 - 24428461
Alignment:
| Q |
63 |
ttggtgatgatgattgagaaagaaattaccattggtgataatagcgctggtct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24428513 |
ttggtgatgatgattgagaaagaaattaccattggtgataatagcgctggtct |
24428461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 80 - 111
Target Start/End: Complemental strand, 486 - 455
Alignment:
| Q |
80 |
gaaagaaattaccattggtgataatagcgctg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
486 |
gaaagaaattaccattggtgataatagcgctg |
455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University