View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5198-Insertion-8 (Length: 266)
Name: NF5198-Insertion-8
Description: NF5198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5198-Insertion-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 266
Target Start/End: Complemental strand, 9618989 - 9618731
Alignment:
| Q |
8 |
aatagctgacatggtgcaggatggagaatgaagggagttttttagttgatttgttgatgctggaagtgaggttgtgttctgattttgtttgtcttactta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9618989 |
aatagctgacatggtgcaggatggagaatgaagggagttttttagttgatttgttgatgctggaagtgaggttgtgttctgattttgtttgtcttactta |
9618890 |
T |
|
| Q |
108 |
ctgtgttctgtttttgatgggagtttagtttgagatgtgatttgacgtttttgatggaagtgaggacgtgtgacgaagtcaccgacaattttcccaagaa |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| | |
|
|
| T |
9618889 |
ctgtgttctgttttttatgggagtttagtttgagatgtgatttgacgtttttgatggaagtgaggacgtgtgatgaagtcaccgacaattctcccaagga |
9618790 |
T |
|
| Q |
208 |
tcaaccttaagcccaaaacattttatcatagttttagatgtctttatgaaacacatcca |
266 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9618789 |
tcaaccttaagcccaaaacagtttatcatagttttagatgtatttatgaaacacatcca |
9618731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 88
Target Start/End: Original strand, 34131297 - 34131325
Alignment:
| Q |
60 |
gttgatgctggaagtgaggttgtgttctg |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34131297 |
gttgatgctggaagtgaggttgtgttctg |
34131325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University