View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5198-Insertion-9 (Length: 124)
Name: NF5198-Insertion-9
Description: NF5198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5198-Insertion-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 124
Target Start/End: Complemental strand, 5810736 - 5810619
Alignment:
| Q |
7 |
aggatcattctccatcagtcgattagaggtttctgaagtaaattggaatgctctcgataattgggatcaatttgatgatggatacaatgtggcacaatgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
5810736 |
aggatcattctccatcagtcgattagaggtttctgaagtaaattggaatgctcttgacaattgggatcattttaatgatggatacaatgtggcacaatgc |
5810637 |
T |
 |
| Q |
107 |
ataagggctgtggctgaa |
124 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5810636 |
ataagggctgtggctgaa |
5810619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 78 - 124
Target Start/End: Complemental strand, 32702743 - 32702697
Alignment:
| Q |
78 |
ttgatgatggatacaatgtggcacaatgcataagggctgtggctgaa |
124 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32702743 |
ttgataatggatacgatgtggcacaatgcataagggctgtggctgaa |
32702697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 80 - 124
Target Start/End: Complemental strand, 32626958 - 32626914
Alignment:
| Q |
80 |
gatgatggatacaatgtggcacaatgcataagggctgtggctgaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
32626958 |
gatgatggatacaatgtggcacaatgcatgagagctttggctgaa |
32626914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 80 - 124
Target Start/End: Complemental strand, 27735963 - 27735919
Alignment:
| Q |
80 |
gatgatggatacaatgtggcacaatgcataagggctgtggctgaa |
124 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
27735963 |
gatgatggatacaatatggcacaatgcattagggctgtggctgaa |
27735919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University