View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5198_low_7 (Length: 304)
Name: NF5198_low_7
Description: NF5198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5198_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 13616710 - 13616410
Alignment:
| Q |
1 |
ctagggatatcaataagaccatctagcaacgagccatcacttaaccatctatcgttccaaagagaaatattatcacccttcacatcgacttccttcccta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13616710 |
ctagggatatcaataagaccatctagcaacgagccatcacttaaccatctatcattccaaagagaaatattatcacccttcatatcgacttccttcccta |
13616611 |
T |
 |
| Q |
101 |
gcaaaaaattatgtagaacacaatctcctcttcacaaaaattgggttatgttcaatactagccttcaaaaaatttgaataaggaaacacacaacttttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13616610 |
gcaaaaaattatgtagaacacaatctcctcttcacaaaaattgggttatgttcaatactagccttcaaaaaatttgaataaggaaacacacaacttttaa |
13616511 |
T |
 |
| Q |
201 |
cagcatttactaaatcaaaagcaataggtctctaaagctcctaccatcatcattcttctcaacatagaannnnnnnnaaggttatccaatgaatgccttt |
300 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13616510 |
cagcattgactaaatcaaaagcaataggtctctaaagctcctaccatcatcattcttctcaacatagaattttttttaaggttatccaatgaatgccttt |
13616411 |
T |
 |
| Q |
301 |
g |
301 |
Q |
| |
|
| |
|
|
| T |
13616410 |
g |
13616410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University