View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5198_low_8 (Length: 240)
Name: NF5198_low_8
Description: NF5198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5198_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 13616695 - 13616916
Alignment:
| Q |
1 |
ttattgatatccctagtgacatcttgattccacatgataagccttagaacattctattgattacatttgtagttgatgataatgataatgtggctaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13616695 |
ttattgatatccctagtgacatcttgattccacatgataagccttagaacattctattgattacatttgtagttgatgataatgataatgtggctaatat |
13616794 |
T |
 |
| Q |
101 |
tgtcaatacattgttatctcctatggtgtaatagagggtaagcaaatttgaagggcgaaaaagatggtgattactcatctaaaaatgcttataatttttc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13616795 |
tgtcaatacattgttatctcctatg--gtaatagagggtaagcaaatttgaagggcgaaaaggatggtgattactcatctaaaaatgcttataatttttc |
13616892 |
T |
 |
| Q |
201 |
ttctagtaagttagttgatacttc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13616893 |
ttctagtaagttagttgatacttc |
13616916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University