View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5199-Insertion-11 (Length: 208)
Name: NF5199-Insertion-11
Description: NF5199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5199-Insertion-11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 8 - 208
Target Start/End: Complemental strand, 40787206 - 40787006
Alignment:
| Q |
8 |
gtttaatttcttctagtaataatcttttacacaagaggatgaaccgtattgagtggggttgcatgttcaatctttggcttttggtagtattgtattttag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787206 |
gtttaatttcttctagtaataatcttttacacaagaggatgaaccgtattgagtggggttgcatgttcaatctttggcttttggtagtattgtattttag |
40787107 |
T |
|
| Q |
108 |
ctatgatttacttgatgataatattatttgacgagtgacaaatgactaatttagagtaatacaaatttttcaacagttactaattactcactttcacgca |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787106 |
ctataatttacttgatgataatattatttgacgagtgacaaatgactactttagagtaatacaattttttcaacagttactaattactcactttcacgca |
40787007 |
T |
|
| Q |
208 |
t |
208 |
Q |
| |
|
| |
|
|
| T |
40787006 |
t |
40787006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University