View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5199-Insertion-9 (Length: 140)
Name: NF5199-Insertion-9
Description: NF5199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5199-Insertion-9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 13 - 140
Target Start/End: Original strand, 21180783 - 21180910
Alignment:
| Q |
13 |
tatatctctgaagtgacacatacacattagatagaactctcttactttggcaacaagaacattggttgaaagagttacatcaattcctattagaagcatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21180783 |
tatatctctgaagtgacacatacacattagatagaactctcttactttggcaacaagaacattggttgaaagagttacatcaattcctattagatgcatt |
21180882 |
T |
 |
| Q |
113 |
cttgaatacacaacattatataaaacaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
21180883 |
cttgaatacacaacattatataaaacaa |
21180910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University