View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201-Insertion-3 (Length: 123)
Name: NF5201-Insertion-3
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 5e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 64 - 123
Target Start/End: Original strand, 24360499 - 24360558
Alignment:
| Q |
64 |
caactttgttttataatgaagccaagttatttgcttccacttcacataatgatctctctc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360499 |
caactttgttttataatgaagccaagttatttgcttccacttcacataatgatctctctc |
24360558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 68 - 113
Target Start/End: Original strand, 41832434 - 41832479
Alignment:
| Q |
68 |
tttgttttataatgaagccaagttatttgcttccacttcacataat |
113 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||||||| |
|
|
| T |
41832434 |
tttgttttataaccaagctaagttttttgcttccacttcacataat |
41832479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University