View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201-Insertion-5 (Length: 407)
Name: NF5201-Insertion-5
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201-Insertion-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 5e-78; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 8 - 163
Target Start/End: Complemental strand, 5016383 - 5016229
Alignment:
| Q |
8 |
gaaatggatttggtgtgactacttggttggatactcaaagtgttgttttagattttgtctctggtgcttgtattgtaagttgtaacttcacatggggaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5016383 |
gaaatggatttggtgtgactacttggttggatactcaa-gtgttgttttagattttgtctctggtgcttgtattgtaagttgtaacttcacatggggaat |
5016285 |
T |
|
| Q |
108 |
ggctacttatgtgcattgcatttccatctttatcaattactcccatttaagactaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5016284 |
ggctacttatgtgcattgcatttccatctttatcaattactcccatttaagactaa |
5016229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 213 - 407
Target Start/End: Complemental strand, 5016214 - 5016030
Alignment:
| Q |
213 |
tattcattataggccacattggtaattttcaataaaaatannnnnnnnaaattgatttgaaaatatgcacgttcttttcttttttaactgctccaggaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5016214 |
tattcattataggccacattggtaattttcaataatttttttttttttaaattgatttgaaaatatgcacgttcttttcttttttaactgctccaggaaa |
5016115 |
T |
|
| Q |
313 |
ttcgctcctttttcagaacccaccacaccacataagcagaaaaatatcatttatcaattaatttggtgtccaacccttgtaaccatttagcaaag |
407 |
Q |
| |
|
||||||||||||||||||| || ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5016114 |
ttcgctcctttttcagaac---ccccacca-------aaaaaaatatcatttatcaattaatttggtgtccaacccttgtaaccatttagcaaag |
5016030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 376
Target Start/End: Complemental strand, 5015991 - 5015955
Alignment:
| Q |
340 |
ccacataagcagaaaaatatcatttatcaattaattt |
376 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5015991 |
ccacataagcagtaaaatatcatttatcaattaattt |
5015955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University