View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_high_26 (Length: 242)
Name: NF5201_high_26
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_high_26 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 40380649 - 40380427
Alignment:
| Q |
19 |
tccttaacatcagattgttgttgagctgatatgaaaaatggagttctgtttcttacttcttttcttcttcctcctgtccaacctagtatcgataatttgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40380649 |
tccttaacatcagattgttgttgagctgatatgaaaaatggagttctgtttcttacttcttttcttcttcctcctgtccaacctagtatggataatttgg |
40380550 |
T |
 |
| Q |
119 |
tagaaaccatgtaggaacaacttgtggccatctttaatttagtggtgnnnnnnngcctttaatggccaacaagaacttacatgagggtcttattagtttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| ||||||| | ||| ||||||||| || |
|
|
| T |
40380549 |
tagaaaccatgtaggaacaacttgtggccatgtttgatttagtggtg-ttttttgcctttaatggccaacaagtacttacaagtgggacttattagtgtg |
40380451 |
T |
 |
| Q |
219 |
catattgcttagcttcactccttc |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40380450 |
catattgcttagcttcactccttc |
40380427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University