View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_high_29 (Length: 234)
Name: NF5201_high_29
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_high_29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 6942703 - 6942934
Alignment:
| Q |
7 |
atatttgcattgaggatcgttattggtgttggac----acatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgcatgcat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942703 |
atatttgcattgaggatcgttattggtgttggacttggacatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgcatgcat |
6942802 |
T |
 |
| Q |
103 |
tgtacttccagaaaaatggatgagataatttatcaaactgagtattgcttcaaagattggttgcatcaagaatctatcaaaatggttgagagaatttatc |
202 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
6942803 |
tatacttccagaaaaatggatgagataatttatcgaactgagtattgcttcaaagattggttgcatccagaatctatcaaaatgattgagagaatttatc |
6942902 |
T |
 |
| Q |
203 |
agatgctctttctacgtgttttttcttgattt |
234 |
Q |
| |
|
|||||||||||||| |||||||||||| |||| |
|
|
| T |
6942903 |
agatgctctttctatgtgttttttctttattt |
6942934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University