View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_high_6 (Length: 409)
Name: NF5201_high_6
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 155 - 256
Target Start/End: Original strand, 7879629 - 7879726
Alignment:
| Q |
155 |
aaacatatgttcaattctctcgttgtgcactttatatatatggaaagtatatatgcaagttgtcaactaaaagcttttcaatgaagagaatgcaacaata |
254 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7879629 |
aaacatatgttcaattctctcattgcgcactttatgt----ggaaagtatatatgcaagctgtcaactaaaagcttttcaatgaagagaatgcaagaata |
7879724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 70 - 143
Target Start/End: Original strand, 7909101 - 7909171
Alignment:
| Q |
70 |
taacacaacttgaagtcttagcactgtgggaaagctttatgcacatgttttagagaaactgtgacttgcacaat |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
7909101 |
taacacaacttgaagtcttagcactgt-ggaaagctttat--acatgttttagagaaactatgacttgcacaat |
7909171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 304 - 349
Target Start/End: Original strand, 7905528 - 7905573
Alignment:
| Q |
304 |
gagattatttgagaaagttgggaagataaggagtagacttaaaatt |
349 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
7905528 |
gagattatttgagaaagttgggaggataaggagctgacttaaaatt |
7905573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University