View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_low_11 (Length: 349)
Name: NF5201_low_11
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 35302586 - 35302844
Alignment:
| Q |
19 |
aagtctaaactccaaacacaaattgctttgcctcaaactcaaccaattaagtgtagtaaactgaattaggagcatactagctgtttgcatttacactata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35302586 |
aagtctaaactccaaacacaaattgctttgcctcaaactcaaccaattaagtgtagtaaactgaattaggagcatactagttgtttgcatttacactata |
35302685 |
T |
|
| Q |
119 |
tggtacacagaaaaaaccattatacatgattatggaaagtttgactt---cataattaggatttaggagcatacttgcaagctcttcacgaacctctagg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35302686 |
tggtacacagaaaaaaccattatacataattatggaaagtttcacttcaccataattaggatttaggagcataattgcaagctcttcacgaacctctagg |
35302785 |
T |
|
| Q |
216 |
gtttttgaaagaggcaaatgtgaactctttc-ttatgtgaaatgaggttgtatttatag |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
35302786 |
gtttttgaaagaggcaaatgtgaactctttctttatgtgaaatgacgttgtatttatag |
35302844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University