View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_low_13 (Length: 326)
Name: NF5201_low_13
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 44089141 - 44088910
Alignment:
| Q |
1 |
cctgcttttatcattgctgttgcttctgctagtgctactactactagtattttgtctatcttcactgaaaaatcttttgattctccattctttatctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44089141 |
cctgcttttatcattgctgttgcttctgctagtgctactactactagtattttgtctatcttcactgaaaaatcttttgattctccattctttatctttt |
44089042 |
T |
 |
| Q |
101 |
tgttctacctcagagccattttgtactttagtagtcttcttcatccaatcaaaagaaattggaaagaacatcttcaataggaaggtttcactgtccatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44089041 |
tgttctacctcagagccattttgtactttagtagtcttcttcatccaatcaaaagaaattggaaagaacatcttcaataggaaggtttcactgtccatgc |
44088942 |
T |
 |
| Q |
201 |
tttcaactcttaacattttaccatgtctattg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44088941 |
tttcaactcttaacattttaccatgtctattg |
44088910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 282 - 317
Target Start/End: Complemental strand, 44088860 - 44088825
Alignment:
| Q |
282 |
gttgaggttgttgaaatttactatacacaggttctg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44088860 |
gttgaggttgttgaaatttactatacactggttctg |
44088825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University