View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_low_15 (Length: 300)
Name: NF5201_low_15
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 7 - 286
Target Start/End: Original strand, 39980735 - 39981014
Alignment:
| Q |
7 |
ggagcagagacagtaagtaactactacagaaaggagcaaatgagtctgacaaaagagatcagaaagtgttgaatcagtgcttcagaaaaacaaaacagca |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39980735 |
ggagcaaagacagtaagtaactactacagaaaggagcaaatgagtctgacaaaagagatcagaaagtgttgaatcagtgcttcagaaaaacaaaacagca |
39980834 |
T |
 |
| Q |
107 |
acatgggaggatcttctgcagatcttcatcatcatgaatcagatatagaactcattgctcctgagaacagcacaaagttaagcactactgagtccaaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39980835 |
acatgggaggatcttctgcagatcttcatcatcatgaatcagatatagaactcattgctcctgagaacagcacaaagttaagcactactgagtccaaatc |
39980934 |
T |
 |
| Q |
207 |
tgtcacagatattgaccataacatagaagaagatgcagactatgttgaggtgaccatggacattcaaggtgactctgttg |
286 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39980935 |
tgtcacagatgttgaccataacatagaagaagatgcagactatgttgaggtgaccatggacattcaaggtgactctgttg |
39981014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University