View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_low_25 (Length: 247)
Name: NF5201_low_25
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_low_25 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 11 - 247
Target Start/End: Complemental strand, 52546542 - 52546322
Alignment:
| Q |
11 |
gaacaacaggaagtgtgtgtgctgacatatatgaaaatcagccaacacttagtaaccaagttaatagactagctgacttgtggtgtcccattggacaaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
52546542 |
gaacaacaggaagtgtgtgtgctgacatatatgaaaatcagccaacacttag----------------ctagctgacttgcggtgtcccattggacaaaa |
52546459 |
T |
 |
| Q |
111 |
gatcacccaaattaaatttgctagctatggattgccacaaggtacttgtggaaattttcgagaaggaacttgtcatgctcacaaatcatatgatgctcct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52546458 |
gatcacccaaattaaatttgctagctatggattgccacaaggtacttgtcgaaactttcgagaaggaacttgtcatgctcacaaatcatatgatgctcct |
52546359 |
T |
 |
| Q |
211 |
caaagggtatatttaccatttcaattactgtcaattc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52546358 |
caaagggtatatttaccatttcaattactgtcaattc |
52546322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University