View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_low_32 (Length: 229)
Name: NF5201_low_32
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 52545977 - 52545756
Alignment:
| Q |
1 |
ctttcatatttactctgcttcctaactcttgtggtaacgattaacatggattaatggataaataatttggctctaaatgatttagtattttctttttatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52545977 |
ctttcatatttactctgcttcctaactcttgtggtaacgattaacatggattaatggataaataatttggctctaaacgatttagtattttctttttatg |
52545878 |
T |
|
| Q |
101 |
ttttggcaggactgcattggcaagcaatcttgcatggtaactgtaactcctgaaaattttggtggagacccttgtccaggaattgcaaagaagttctcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52545877 |
ttttggcaggactgcattggcaagcaatcttgcatggtaactgtaactcctgaaaattttggtggagacccttgtccaggaattgcaaagaagttctcag |
52545778 |
T |
|
| Q |
201 |
ttgaagccctatgcagctagga |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52545777 |
ttgaagccctatgcagctagga |
52545756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University