View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5201_low_33 (Length: 226)
Name: NF5201_low_33
Description: NF5201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5201_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 43953415 - 43953277
Alignment:
| Q |
1 |
tcttccagctattatgattttgtagacaatgaactcaccaatgcttaacttaatcaaggtttcaacatgtgcaagagtaaccatgaatgtcctccattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
43953415 |
tcttccagctattatgattttgtagacaatgaactcaccaatgcttaacttaatcaaggtttcaacatgtgcatgagtaaccatgagtgtcctccattat |
43953316 |
T |
 |
| Q |
101 |
tatgctgctcctcggagaaattttgttgtcttatttgac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953315 |
tatgctgctcctcggagaaattttgttgtcttatttgac |
43953277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 139 - 217
Target Start/End: Complemental strand, 43953234 - 43953156
Alignment:
| Q |
139 |
ctaatttatttctatgccatgggatgcaacatcaatgattgtgacaccgccaaataaacatttgttacatattcttcga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
43953234 |
ctaatttatttctatgccatgggatgcaacatcaatgattgtgacaccgccaaataaacatttgttacattttgttcga |
43953156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University