View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5202-Insertion-11 (Length: 123)
Name: NF5202-Insertion-11
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5202-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr8 (2 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 7 - 123
Target Start/End: Complemental strand, 5810736 - 5810619
Alignment:
| Q |
7 |
aggatcattctcc-tcagtcgattagaggtttctgaagtaaattggaatgctctcgataattgggatcaatttgatgatggatacaatgtggcacaatgc |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
5810736 |
aggatcattctccatcagtcgattagaggtttctgaagtaaattggaatgctcttgacaattgggatcattttaatgatggatacaatgtggcacaatgc |
5810637 |
T |
|
| Q |
106 |
ataagggctgtggctgaa |
123 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5810636 |
ataagggctgtggctgaa |
5810619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 77 - 123
Target Start/End: Complemental strand, 32702743 - 32702697
Alignment:
| Q |
77 |
ttgatgatggatacaatgtggcacaatgcataagggctgtggctgaa |
123 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32702743 |
ttgataatggatacgatgtggcacaatgcataagggctgtggctgaa |
32702697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 79 - 123
Target Start/End: Complemental strand, 32626958 - 32626914
Alignment:
| Q |
79 |
gatgatggatacaatgtggcacaatgcataagggctgtggctgaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
32626958 |
gatgatggatacaatgtggcacaatgcatgagagctttggctgaa |
32626914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 79 - 123
Target Start/End: Complemental strand, 27735963 - 27735919
Alignment:
| Q |
79 |
gatgatggatacaatgtggcacaatgcataagggctgtggctgaa |
123 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
27735963 |
gatgatggatacaatatggcacaatgcattagggctgtggctgaa |
27735919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University