View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5202-Insertion-9 (Length: 72)
Name: NF5202-Insertion-9
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5202-Insertion-9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 7 - 69
Target Start/End: Original strand, 37746776 - 37746838
Alignment:
| Q |
7 |
aactacaatttcaggtgacatttttgttatctctctcaatttttcactgacttccttcatcgt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37746776 |
aactacaatttcaggtgacatttttgttatctctctcaatttttcactgacttccttcatcgt |
37746838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 46
Target Start/End: Original strand, 35849715 - 35849754
Alignment:
| Q |
7 |
aactacaatttcaggtgacatttttgttatctctctcaat |
46 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35849715 |
aactgcaaattcaggtggcatttttgttatctctctcaat |
35849754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University