View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5202_high_16 (Length: 236)
Name: NF5202_high_16
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5202_high_16 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 31078444 - 31078679
Alignment:
| Q |
1 |
ccgagggtgtgtttaggaaaggaaatggcgttcttgcagatgaagagggtggttgcagggatcatgaggcagtttagggtggttcctgcgatggataaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31078444 |
ccgagggtgtgtttaggaaaggaaatggcgttcttgcagatgaagagggtggttgcagggatcatgaggcagtttagggtggttcctgcaatggataaag |
31078543 |
T |
 |
| Q |
101 |
gggttgagccggagtacattgcacaccttacctcattgatgaagggtggcttcttggtaagaattgagaagcgaagccacaaagatcaataaaaattaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078544 |
gggttgagccggagtacattgcacaccttacctcattgatgaaaggtggcttctcggtaagaattgagaagcgaagccacaaagatcaataaaaattaat |
31078643 |
T |
 |
| Q |
201 |
aaggtcatgttaactagtatccctgagatattagtt |
236 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| |
|
|
| T |
31078644 |
aaggtcatgttaactagtattgctgatatattagtt |
31078679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 4 - 173
Target Start/End: Original strand, 31127765 - 31127934
Alignment:
| Q |
4 |
agggtgtgtttaggaaaggaaatggcgttcttgcagatgaagagggtggttgcagggatcatgaggcagtttagggtggttcctgcgatggataaagggg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31127765 |
agggtgtgtttaggaaaggaaatggcgttcttgcagatgaaaagggtggttgccgggatcatgaggcagtttagggtggttcctgcaatggataaagggg |
31127864 |
T |
 |
| Q |
104 |
ttgagccggagtacattgcacaccttacctcattgatgaagggtggcttcttggtaagaattgagaagcg |
173 |
Q |
| |
|
|||||||||||| | |||||||||||| || | ||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
31127865 |
ttgagccggagttcgctgcacaccttacttcgataatgaaaggtggcttcctggtaaagattgagaagcg |
31127934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University