View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5202_high_17 (Length: 228)
Name: NF5202_high_17
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5202_high_17 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 30 - 228
Target Start/End: Original strand, 35243437 - 35243640
Alignment:
| Q |
30 |
ctgaccaaagacaccaaaatcactcccacttactaatttttacactgcacacttctcttcgaactcaaactctcaactcaaaattccttttaacattagc |
129 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35243437 |
ctgaccaaagacaccaaaaccactcccacttactaatttttacattgcacacttctctttaaactcaaactctcaactcaaaattccttttaacattaac |
35243536 |
T |
 |
| Q |
130 |
tacaatatatgctctcatccgcaactactttgtatacatgccacctgcttgcatccacaaccataaca------ctaggcccatcttaaatcacctttat |
223 |
Q |
| |
|
|||||||| |||||||| | ||||| ||||| |||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
35243537 |
tacaatat-tgctctcaccagcaacaactttctatacatgccacctgcttgcatccgcaaccataacactagggctaggcccatcccaaatcacctttat |
35243635 |
T |
 |
| Q |
224 |
cttct |
228 |
Q |
| |
|
||||| |
|
|
| T |
35243636 |
cttct |
35243640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University