View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5202_low_20 (Length: 225)

Name: NF5202_low_20
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5202_low_20
NF5202_low_20
[»] chr7 (1 HSPs)
chr7 (1-222)||(47430644-47430868)
[»] chr4 (1 HSPs)
chr4 (58-107)||(32028232-32028281)


Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 47430868 - 47430644
Alignment:
1 atgacaaagtaatcaaacggatgtttggtaacatcgtagatttaccaaaatcacagcgatccacaatgatttttaaaaagctacacttggtaacttatgc 100  Q
    ||||||||||||||||| ||||||||||||| ||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| ||| |||    
47430868 atgacaaagtaatcaaatggatgtttggtaagatcgtagattttccaaaaccacggcgatccacaatgatttttaaaaagctacacttggtagcttctgc 47430769  T
101 aaaatcatagtgagtcaccgtgttaacaaacatatactactctaatgctgatgacaaacaaatatatgacattaagaaagagag---agagtgaaattca 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||    
47430768 aaaatcatagtgagtcaccgtgttaacaaacatatactactctaatgctgatgacaaacaaatatatgacattaagaaagagagatcagagtgaaattca 47430669  T
198 cattcagattcagggatgacacatg 222  Q
    |||||||||||||||||||||||||    
47430668 cattcagattcagggatgacacatg 47430644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 107
Target Start/End: Original strand, 32028232 - 32028281
Alignment:
58 gatccacaatgatttttaaaaagctacacttggtaacttatgcaaaatca 107  Q
    ||||||| ||||||||| |||||||||||||  || ||||||||||||||    
32028232 gatccactatgatttttcaaaagctacactttatagcttatgcaaaatca 32028281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University