View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5202_low_8 (Length: 255)
Name: NF5202_low_8
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5202_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 34276227 - 34275973
Alignment:
| Q |
1 |
caacatataatttcatacaaaattgctgtcagtgcaagtgctctcatttgaatcagagatatcttctccaacacttgaagttgaatcatcggtggacctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34276227 |
caacatataatttcatacaaaattgctgtcagtgcaagtgctctcatttgaatcagagatatcttctccaacacttgaagctgaatcatcggtggacctg |
34276128 |
T |
|
| Q |
101 |
attgaatcgatgagatcccgcatcatgtcgatcctatcttgtagatcatcaatgtttgaaaaaagatcttcaaagaaaatatcagtatcagtgcattcaa |
200 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34276127 |
attgagtcgatgagatcccgcatcacgtcgatcctatcttgtagatcgtcaatgtttgaaaaaagatcttcaaagaaaatatcagtatcagtgcattcaa |
34276028 |
T |
|
| Q |
201 |
gcacaggtacagcttcaccaaagttttcagttgaatcttcatttagctcttctgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34276027 |
gcacaggtacagcttcaccaaagttttcagttgaatcttcatttagctcttctgt |
34275973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University