View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5202_low_9 (Length: 253)

Name: NF5202_low_9
Description: NF5202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5202_low_9
NF5202_low_9
[»] chr8 (1 HSPs)
chr8 (1-246)||(10565637-10565883)


Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 10565637 - 10565883
Alignment:
1 ccaatgcaaaacagtactattattcatagaagggttttgtgcccttatgggtagatattgtacaaacttaactctcccttttttgtctttcgatcaacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10565637 ccaatgcaaaacagtactattattcatagaagggttttgtgcccttatgggtagatattgtacaaacttaactctcccttttttgtctttcgatcaacat 10565736  T
101 caatggctacatatatgacaatgaaagaagattaattaga-aataaaattgccaccaaaccaacagtttgcccaatagggaaagtgtaacaagagtgaga 199  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10565737 caatggctacatatatgacaatgaaagaagattaattagacaataaaattgccaccaaaccaacagtttgcccaatagggaaagtgtaacaagagtgaga 10565836  T
200 ggaccacaattatccttattggaccacttcttttagtagaataatct 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
10565837 ggaccacaattatccttattggaccacttcttttagtagaataatct 10565883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University