View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5203-Insertion-2 (Length: 369)
Name: NF5203-Insertion-2
Description: NF5203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5203-Insertion-2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 6 - 369
Target Start/End: Original strand, 24790669 - 24791032
Alignment:
| Q |
6 |
caccgacgccacaccaaaaccycttctccgaccacctttcctgccaccaccattcctccgaaacctctctctcaacacagccaacttcctcagctccgta |
105 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24790669 |
caccgacgccacaccaaaacctcttctccgaccacctttcctgccaccaccattcctccgaaacctctctctcaacacagccagcttcctcagctccgtc |
24790768 |
T |
|
| Q |
106 |
accaccgccacatcagcaaccctcatcttctctgcatcccaaggtgaatgcgcttcttgtaacttcacataagctctcttcatagacgacaccgtttcga |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
24790769 |
accaccgccacgtcagcaaccctcatcttctctgcatcccaaggtgaatgcgcttcttgtaacttcacatacgctctcttcatagaagacaccgtttcga |
24790868 |
T |
|
| Q |
206 |
agatttcttccattaatgyttccatttgcttcaccttcaaaatcttcatacccatcattttgtcttcgttgaattcgtcattttcctccaaagggtcacc |
305 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24790869 |
agatttcttccattaatgcttccatttgcttaaccttcaaaatcttcatacccatcattttgtcttcgttgaattcgtcattttcctccaaagggtcacc |
24790968 |
T |
|
| Q |
306 |
attttcatcctcatcttcgtcgtcatcatcaacatcatcactgtgataatgttcttgttcttcg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24790969 |
attttcatcctcatcttcgtcgtcatcatcaacatcatcactgtgataatgttcttgttcttcg |
24791032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University