View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5203_low_3 (Length: 311)
Name: NF5203_low_3
Description: NF5203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5203_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 164 - 262
Target Start/End: Complemental strand, 24360262 - 24360164
Alignment:
| Q |
164 |
caaaccgttttctttttcaactagactcatcaaccaaccaactcctctttctgtttctctctcactactcttccctaatttgtaagcaaaccccacaac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360262 |
caaaccgttttctttttcaactagactcatcaaccaaccaactcctctttctgtttctctctcactactcttccctaatttgtaagcaaaccccacaac |
24360164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 83 - 130
Target Start/End: Complemental strand, 24360347 - 24360300
Alignment:
| Q |
83 |
caaggccatggagtcaaagacaagaagacacacacacatctaaatatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360347 |
caaggccatggagtcaaagacaagaagacacacacacatctaaatatt |
24360300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 24360411 - 24360376
Alignment:
| Q |
19 |
tgtgattcatgtatgatgattaccttgtgagtgaag |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360411 |
tgtgattcatgtatgatgattaccttgtgagtgaag |
24360376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University