View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5203_low_5 (Length: 239)
Name: NF5203_low_5
Description: NF5203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5203_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 40960267 - 40960471
Alignment:
| Q |
21 |
tgctaatcatgtttagtataactgtgactctttcaggttataatcctcctcctgcttctccaaaggcttgatgcaaaaatttgggctgggcgcatgcaac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960267 |
tgctaatcatgtttagtataactgtgactctttcaggttataatcctcctcctacttctccaaaggcttgatgcaaaaatttgggctgggcgcatgcaac |
40960366 |
T |
|
| Q |
121 |
ttatatacatgaataaaataaaataaaacatgacatgtattctaaaagaaaagcatgatgtacatgcgtcttcttaattactgatttatgctctctctcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960367 |
ttatatacatgaataaaataaaataaaacatgacatgtattctaaaagaaaagcatgatgtacatgcgtcttcttaattactgatttatgctctctctcc |
40960466 |
T |
|
| Q |
221 |
ctttg |
225 |
Q |
| |
|
||||| |
|
|
| T |
40960467 |
ctttg |
40960471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 64 - 143
Target Start/End: Original strand, 40953722 - 40953798
Alignment:
| Q |
64 |
tcctcctcctgcttctccaaaggcttgatgcaaaaatttgggctgggcgcatgcaacttatatacatgaataaaataaaa |
143 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||||| ||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
40953722 |
tcctcatcctccttctctaaaggcttgatgcaaaaaattggg---ggcgcatggaacttatatatatgaataaaataaaa |
40953798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 44 - 99
Target Start/End: Original strand, 40954224 - 40954279
Alignment:
| Q |
44 |
gtgactctttcaggttataatcctcctcctgcttctccaaaggcttgatgcaaaaa |
99 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
40954224 |
gtgattctttcaggttataatcctcctcctgcttctccgaagactttatgcaaaaa |
40954279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University