View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5204-Insertion-9 (Length: 124)
Name: NF5204-Insertion-9
Description: NF5204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5204-Insertion-9 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 4e-48; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 11689171 - 11689055
Alignment:
| Q |
8 |
catatcttatatgttttccttataacagtaagcttcctctttcaatcatattggttggtgttggagacggaccatgggacatgatgaaagaatttgacga |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11689171 |
catatcttatatgttttatttataacagtaagcttcctctttcaattatattggttggtgttggagatggaccatgggacatgatgaaagaatttgacga |
11689072 |
T |
|
| Q |
108 |
taacattccatctcgtg |
124 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
11689071 |
taatattccatctcgtg |
11689055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 41 - 95
Target Start/End: Original strand, 30955111 - 30955165
Alignment:
| Q |
41 |
ttcctctttcaatcatattggttggtgttggagacggaccatgggacatgatgaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
30955111 |
ttcctctttcaatcatattggttggtgttggagatggaccttgggacatggtgaa |
30955165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 32 - 95
Target Start/End: Original strand, 30958940 - 30959003
Alignment:
| Q |
32 |
acagtaagcttcctctttcaatcatattggttggtgttggagacggaccatgggacatgatgaa |
95 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
30958940 |
acagtaaatttcctctatcaatcatattggttggtgttggagatggaccttgggacaagatgaa |
30959003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 4e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 7474122 - 7474194
Alignment:
| Q |
32 |
acagtaagcttcctctttcaatcatattggttggtgttggagacggaccatgggacatgatgaaagaatttga |
104 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| || ||||| |
|
|
| T |
7474122 |
acagtaaatttcctctttcgatcatattggttggtgttggagatggaccttgggacatgatgaaggagtttga |
7474194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 116
Target Start/End: Complemental strand, 34392570 - 34392503
Alignment:
| Q |
49 |
tcaatcatattggttggtgttggagacggaccatgggacatgatgaaagaatttgacgataacattcc |
116 |
Q |
| |
|
|||||| |||| || || |||||||| || |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
34392570 |
tcaatcgtattagtcggagttggagatgggccatgggacatgatgaaacagtttgacgataacattcc |
34392503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 42 - 114
Target Start/End: Original strand, 44131152 - 44131224
Alignment:
| Q |
42 |
tcctctttcaatcatattggttggtgttggagacggaccatgggacatgatgaaagaatttgacgataacatt |
114 |
Q |
| |
|
|||||| ||||| || |||||||| |||||||| |||||||||||| ||||||| | ||||| ||||||||| |
|
|
| T |
44131152 |
tcctctctcaattattttggttggagttggagatggaccatgggacgagatgaaacactttgatgataacatt |
44131224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.0000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 37318373 - 37318309
Alignment:
| Q |
58 |
ttggttggtgttggagacggaccatgggacatgatgaaagaatttgacgataacattccatctcg |
122 |
Q |
| |
|
|||||||| |||||||| ||||| ||||| ||||||| |||||||||||||| |||||| |||| |
|
|
| T |
37318373 |
ttggttggagttggagatggaccgtgggatatgatgagggaatttgacgataatattccagctcg |
37318309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University