View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5204_high_13 (Length: 316)
Name: NF5204_high_13
Description: NF5204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5204_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 74 - 296
Target Start/End: Original strand, 23545673 - 23545895
Alignment:
| Q |
74 |
tctccatgctcctctacctcctcctccgccaccgcaccacctcgtccttccaaacaaatggtcatcggaaccatcttcggtaaccgtcgcggccatgtct |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23545673 |
tctccatgctcctctacctcctcctccgccaccgcaccacctcgtccttccaaacaaatggtcatcggaaccatcttcggtaaccgtcgcggccatgtct |
23545772 |
T |
|
| Q |
174 |
ggttctgcatccaaaccgaccgtacacacgtcaaacccatcctccttcttgaactccctatctccacaaactccctcgtccacgaaatgcgcaacggcct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23545773 |
ggttctgcatccaaaccgaccgtacacacgtcaaacccatcctccttcttgaactccctatctccacaaactccctcgtccacgaaatgcgcaacggcct |
23545872 |
T |
|
| Q |
274 |
cgttcgcattgccctagaatcca |
296 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23545873 |
cgttcgcattgccctagaatcca |
23545895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University