View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5204_low_14 (Length: 311)
Name: NF5204_low_14
Description: NF5204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5204_low_14 |
 | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0019 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 40 - 286
Target Start/End: Complemental strand, 72985 - 72739
Alignment:
| Q |
40 |
gaataaaaatatagttctttctaaaactatattttcttcctgccgaccttggtaaggtaaggtcatccacctcctcaacctaataccgggcctccaccgt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
72985 |
gaataaaaatatagttctttctaaaactatattttcttcctgccgaccttggtaaggtaaggtcgtccacctcctcaacctaatacagggcctccaccgt |
72886 |
T |
|
| Q |
140 |
ttaagacgacaacttcttttggaaacaaaatatggttcttttatgggttcaacattgggcaaattgtgggtccaacggaatgcaccatggatagatagaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
72885 |
ttaagacgacaacttcttttggaaacaaaatatggttcttttatgagttcaacattgggcaaattgtgggtccatcggaatgcaccatggatagatagta |
72786 |
T |
|
| Q |
240 |
tgggacttagaaaaatgagtaatgatatttgtaccgctgcggttatg |
286 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
72785 |
tgggacttaggaaaatgagtggtgatatttgtacagctgcggttatg |
72739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University