View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5204_low_19 (Length: 250)
Name: NF5204_low_19
Description: NF5204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5204_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 21 - 191
Target Start/End: Original strand, 31320066 - 31320236
Alignment:
| Q |
21 |
tttccttattcttcacaagtctctttccttgaacaaatttgattgtcttgtctttctttaagaattttcttannnnnnnagtttcaactcatgttcttgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31320066 |
tttccttattcttcacaagtctctttccttgaacaaatttgattgtcttgtctttctttaagaattttcttatttttttagtttcaactcatgttcttgc |
31320165 |
T |
 |
| Q |
121 |
agttttccaaatagtgccgccagtgacatttttcctagggattttattttctgaaatggttgtcgcctttg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31320166 |
agttttccaaatagtgccgccagtgacatttttcctagggattttattttctgaaatggttgtcgcctttg |
31320236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University