View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5204_low_21 (Length: 215)
Name: NF5204_low_21
Description: NF5204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5204_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 43220402 - 43220206
Alignment:
| Q |
15 |
tatgatggtaagcttggaagatatgttggtagaaaagcaagaaaataccaaacatggtctattgcaggttatctggtttctaaaatgatgctggaggatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43220402 |
tatgatggtaagcttggaagatatgttggtagaaaagcaagaaaataccaaacatggtctattgcaggttatctggtttctaagatgatgctggaggatc |
43220303 |
T |
 |
| Q |
115 |
cctcacacttggggatgatttcccttgaagaagacaaacagatgaaaccagtgcataaaagatcatcttcttggacttgctaaattattctggtgat |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43220302 |
cctcacacctggggatgatttcccttgaagaagacaaacagatgaaaccagtgcataaaagatcatcttcttggacttgctaaattattctggtgat |
43220206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 43229476 - 43229296
Alignment:
| Q |
15 |
tatgatggtaagcttggaagatatgttggtagaaaagcaagaaaataccaaacatggtctattgcaggttatctggtttctaaaatgatgctggaggatc |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||| | | | ||||||||||||||||||||||||||||| |||||| |||| | || |||||||||||||| | |
|
|
| T |
43229476 |
tatgatggtaaacttggaagatatgttgggaaacaggcaagaaaataccaaacatggtctattgcgggttatttggtggcaaagatgatgctggaggacc |
43229377 |
T |
 |
| Q |
115 |
cctcacacttggggatgatttcccttgaagaagacaaacagatgaaaccagtgcataaaagatcatcttcttggacttgct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43229376 |
cctcacacttggggatgatttcccttgaagaagacaagcagatgaaaccagtgattaaaagatcatcttcttggacttgct |
43229296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University