View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5204_low_6 (Length: 353)
Name: NF5204_low_6
Description: NF5204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5204_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 2 - 332
Target Start/End: Complemental strand, 43220204 - 43219876
Alignment:
| Q |
2 |
ggtgcaagaaagaatgagaatagagaaaaacttagaagtttgaaatttttactagtattttgcaatgagnnnnnnnaattaataagcggtactaatggtc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43220204 |
ggtgcaagaaagaatgagaatagagaaaaacttagaagtttgaaatttttactagtattttgcaatgagtttttttaattaataagcggtactaatggtc |
43220105 |
T |
|
| Q |
102 |
gttttacaattgcacaatgcgtttcaattttactattacgcaatgtgtttcacttgcttccatatacaaggaagtaacnnnnnnnggcagtaactatttc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
43220104 |
gttttacaattgcacaatgcgtttcaattttactattacgcaatgtgtttcacttgcttccatatacaatggagtaaccttttttggcagtaactatttc |
43220005 |
T |
|
| Q |
202 |
aaaaatattttagtcatactcttgtctttaagtttattaaattatccttttactctttatagggccttttataagg-----atgtcattttatcaagtgc |
296 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43220004 |
aaaaatattttagtcatactcttgt-------gttattaaattatccttttactctttctagggccttttataaggatgtcatgtcattttatcaagtgc |
43219912 |
T |
|
| Q |
297 |
aactagggtaacttttgttctgcacaagtagacaac |
332 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43219911 |
aactagggtaacttttgttctacacaagtagacaac |
43219876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University