View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5205_high_6 (Length: 240)
Name: NF5205_high_6
Description: NF5205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5205_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 46160880 - 46160701
Alignment:
| Q |
18 |
catctgtctgtatgcaaactccttgccaaggcaaattcttggacccgcctgtgttaggacgtcacattgacagtaaagttacatagagatctggggtgac |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46160880 |
catctgtctgtatacaaactccttgccaagacaaattcttggacccgcctgtgttaggatgtcacattgacagtaaagttacatagatatctggggtgac |
46160781 |
T |
 |
| Q |
118 |
agtgcttataagagcttacaaaaacaacatatcacatgtttataagctattttagcttaatctcataagctgtctataaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46160780 |
agtgcttataagagcttacaaaaacaacatatcacatgtttataagctattttagcttattctcataagctgtctataaa |
46160701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 46167396 - 46167307
Alignment:
| Q |
18 |
catctgtctgtatgcaaactccttgccaaggcaaattcttggacccgcctgtgttaggacgtcacattgacagtaaagttacatagagat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
46167396 |
catctgtctgtatgcaaactccttgccaaggcaaattcttggacccgcctgtgttaggaaatcacattgatagtaaagttacatagagat |
46167307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 64
Target Start/End: Complemental strand, 46182640 - 46182598
Alignment:
| Q |
22 |
tgtctgtatgcaaactccttgccaaggcaaattcttggacccg |
64 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
46182640 |
tgtctgtatgcaaacttcttgccaaggcaaactcttggacccg |
46182598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 207 - 238
Target Start/End: Complemental strand, 46160662 - 46160631
Alignment:
| Q |
207 |
aatttaattttatcttttgtggtagaaattgc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46160662 |
aatttaattttatcttttgtggtagaaattgc |
46160631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University