View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5205_low_9 (Length: 238)
Name: NF5205_low_9
Description: NF5205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5205_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 7452555 - 7452325
Alignment:
| Q |
1 |
ctccctatatttgtgtcctaattgttgttactaagtaattgacatcaatttaaatttgtgttggactctatttcattaactgaagtattcaannnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452555 |
ctccctatatttgtgtcctaattgttgttactaagtaattgacatcaatttaaatttgtgttggactctatttcattaactgaagtattcaatttttttt |
7452456 |
T |
 |
| Q |
101 |
aaggttatgcaaatgcaatgctcttgtcaacaattaaagaaactagtgaaataggtttggggtgggtggtagatcaaaatattccggtggttagagatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452455 |
aaggttatgcaaatgcaatgctcttgtcaacaattaaagaaactagtgaaataggtttggggtgggtggtagatcaaaatattccggtggttagagatta |
7452356 |
T |
 |
| Q |
201 |
aaaattaaaacctatatggtaggatgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
7452355 |
aaaattaaaacctatatggtagtatgatgtc |
7452325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University