View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5207_low_1 (Length: 499)
Name: NF5207_low_1
Description: NF5207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5207_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-128; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 224 - 490
Target Start/End: Original strand, 47493729 - 47493992
Alignment:
| Q |
224 |
tgagagcttcattttagtgattaaacagccaacatcatcctgacgaactcttgataatcaacgagaccgtcaccatccagatcagccgttttgatcatct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47493729 |
tgagagcttcattttagtgattaaacagtcaacatcatcctgacgaactcttgataatcaacgaggccgtcaccatccagatcagccgttttgatcatct |
47493828 |
T |
 |
| Q |
324 |
gttccagttcttcgtctgtcaccttttctccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttcaatattacggta |
423 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47493829 |
gctccagttcttcgtctgtcaccttttctccgatggtactcaatactgacctcaactgggctcacacgtaatatcaattatatagttc---attacggta |
47493925 |
T |
 |
| Q |
424 |
cgacaaaacaaattatatatgttgaattaattatacctcactgggtgatatgtaaccatcttcatct |
490 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47493926 |
caacaaaacaaattatatatgttgaattaattatacctcactgggtgatatgtaaccatctttatct |
47493992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 15 - 121
Target Start/End: Original strand, 47493488 - 47493592
Alignment:
| Q |
15 |
atatttaaccatattatttatgcaaactaattaaactcataggtaataaatccaaaaggagtgccaaagacatgtcactctttttaactctctttatcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
47493488 |
atatttaaccatattatttatgcaaactaattaaactcataggtaataaatccaaaaggagtgccaaagacatgtcactctttttaactccc--tatcac |
47493585 |
T |
 |
| Q |
115 |
ttccctc |
121 |
Q |
| |
|
||||||| |
|
|
| T |
47493586 |
ttccctc |
47493592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 146 - 199
Target Start/End: Original strand, 47493612 - 47493665
Alignment:
| Q |
146 |
ctctctttcgtactagaatgcattctcttaactgaaattcatatggatttcact |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47493612 |
ctctctttcgcactagaatgcattctcttaaccgaaattcatatggatttcact |
47493665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University