View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_high_16 (Length: 253)
Name: NF5208_high_16
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 235
Target Start/End: Complemental strand, 42004036 - 42003816
Alignment:
| Q |
15 |
caaagggcaggtagcatttgtcttgagccatccatctatacaattcacatgaaaatagtgattacactcgggaattgtcctcaatacttcatttggctga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42004036 |
caaagggcaggtagcatttgtcttgagccatccatctatacaattcacatgaaaatagtgattacactcaggaattgtcctcaatacttcatttggctga |
42003937 |
T |
 |
| Q |
115 |
taatcacaaagacatatagagcaagtgttgtcacttggcctaggcaatcgtccactttcaccaagctgggttttagggtatctttcgattgttgccccgt |
214 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003936 |
tactcacaaagacatatagagcaagtgttgtcactaggcctaggcaatcgtccactttcaccaagctgggttttagggtatctttcgattgttgccccgt |
42003837 |
T |
 |
| Q |
215 |
cgaggcccataacgaaaatcg |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42003836 |
cgaggcccataacgaaaatcg |
42003816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University