View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_high_24 (Length: 215)
Name: NF5208_high_24
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 16715065 - 16715139
Alignment:
| Q |
1 |
ctactttcactttctgttctgtctatgtttcttcttgatatcccacaaaacacgtactccgtacctttaagtact |
75 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16715065 |
ctactttcactttctgttttgtctatgtttcttcttgatatcccacaaaacacgtactccgtacctttaagtact |
16715139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 138 - 209
Target Start/End: Original strand, 16715202 - 16715271
Alignment:
| Q |
138 |
ggatgttccttagaatccgaggatcttgttccttttcttttttagaaaaagaatgggaaatatattcttcga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16715202 |
ggatgttccttagaatccgaggatcttgttc--ttttttttttagaaaaagaatgggaaatatatttttcga |
16715271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University