View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_low_16 (Length: 265)
Name: NF5208_low_16
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 49979678 - 49979442
Alignment:
| Q |
19 |
gatctttggctaggaagaaagggggtctgtgtttgtattatgtatggttttcgaactgataaggtttctagatatgcgttaagaagaaatttgattgata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49979678 |
gatctttggctaggaagaaagggggtctgtgtttgtattatgtatggttttcgaactgataaggtttctagatatgcgttaagaagaaatttgattgata |
49979579 |
T |
 |
| Q |
119 |
gtagaggcatgattgattgtttgaatattctatgtat--gagtatgccggaaacactcagctggagtattcgacttttgttgtgatattaccttaattgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49979578 |
gtagaggcatgattgattgtttgaatattctatgtatgagagtataccggaaacactcagctggagtattcgacttttgttgtgatattaccttaattgt |
49979479 |
T |
 |
| Q |
217 |
gcaagcatagtgtgacactgacatgatgagcatatca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49979478 |
gcaagcatagtgtgacactgacatgatgagcatatca |
49979442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University