View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5208_low_17 (Length: 253)

Name: NF5208_low_17
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5208_low_17
NF5208_low_17
[»] chr8 (1 HSPs)
chr8 (15-235)||(42003816-42004036)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 235
Target Start/End: Complemental strand, 42004036 - 42003816
Alignment:
15 caaagggcaggtagcatttgtcttgagccatccatctatacaattcacatgaaaatagtgattacactcgggaattgtcctcaatacttcatttggctga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
42004036 caaagggcaggtagcatttgtcttgagccatccatctatacaattcacatgaaaatagtgattacactcaggaattgtcctcaatacttcatttggctga 42003937  T
115 taatcacaaagacatatagagcaagtgttgtcacttggcctaggcaatcgtccactttcaccaagctgggttttagggtatctttcgattgttgccccgt 214  Q
    || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42003936 tactcacaaagacatatagagcaagtgttgtcactaggcctaggcaatcgtccactttcaccaagctgggttttagggtatctttcgattgttgccccgt 42003837  T
215 cgaggcccataacgaaaatcg 235  Q
    |||||||||||||||||||||    
42003836 cgaggcccataacgaaaatcg 42003816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University