View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_low_20 (Length: 245)
Name: NF5208_low_20
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 44861583 - 44861812
Alignment:
| Q |
1 |
attaacataacaacaaattactagacttcgtctctatttgttatatatatnnnnnnnnnnn-cataacaaattcagagacatctctttagaagagcggaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861583 |
attaacataacaacaaattactagacttcgtctctctttgttatatatataaaaaaaaaaaacataacaaattcagagacatctctttagaagagcggaa |
44861682 |
T |
 |
| Q |
100 |
attgtcgactactctttaaatcttgctcaaaatctactttatccaacagaagattatgcatccaatgtattggagaaaaatttgaacaccaaccatcatc |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861683 |
attgtcaactactctttaaatcttgctcaaaatctactttatccaacagaagattatgcatccaatgtattggagaaaaatttgaacaccaaccatcatc |
44861782 |
T |
 |
| Q |
200 |
cactcgacataaaagagagaaccattcagc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44861783 |
cactcgacataaaagagagaaccattcagc |
44861812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University