View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_low_21 (Length: 238)
Name: NF5208_low_21
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 43797275 - 43797469
Alignment:
| Q |
24 |
taacaggattatcctttggtcttcttgagtatatgtttcattgattccttatgagtttagtctttgtaactttcgtttttcttgtcccactttttatctt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43797275 |
taacaggattatcctttggtcttcttgagtatatgtttcattgattccttatgagtttagtctttgtaactttcgtttttcttgtccaactttttatctt |
43797374 |
T |
|
| Q |
124 |
tggtattctttaatttgagtaaggttttcaatgagacaattgttaatcatgcatgcacgtatttgttttcttgggtttttaagttatacatgttgtctat |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797375 |
tggtattc-----tttgagtaaggttttcaatgagacaattgttaatcatgcatgcacgtatttgttttcttgggtttttaagttatacatgttgtctat |
43797469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 23 - 90
Target Start/End: Original strand, 43798380 - 43798447
Alignment:
| Q |
23 |
ttaacaggattatcctttggtcttcttgagtatatgtttcattga-ttccttatgagtttagtctttgt |
90 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43798380 |
ttaacaggattatgctt-ggtcttcttgagtacatgtttcattgatttccttatgagtttagtctttgt |
43798447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University