View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_low_24 (Length: 228)
Name: NF5208_low_24
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 50948177 - 50948370
Alignment:
| Q |
21 |
tgacggagaattggtttcgtgaatttgtgtgtttaggaaatttatctgatatagtttgagtgtgtttgccagcttttagagactatgctatctctagttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50948177 |
tgacggagaattggtttcgtgaatttgtgtgtttaggaaatttatctgatatagtttgagtgtgtttgccagcttttagagactatgctatctctagttg |
50948276 |
T |
|
| Q |
121 |
gctgtattaaatattgtttgtgtaatttgcagactgttccatttctttgctcttttcaggtttttcgtactgtcttatcatttggctttctctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50948277 |
gctgtattaaatattgtttgtgtaatttgcagactgttccatttctttgctcttttcaggtttttcatactgtcttatcatttggctttctctg |
50948370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 15855663 - 15855723
Alignment:
| Q |
51 |
gtttaggaaatttatctgatatagtttgagtgtgtttgccagcttttagagactatgctat |
111 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
15855663 |
gtttaggaaatttatctgaaatagtttggatgtgtttgccagcttttatagactatgctat |
15855723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 80 - 214
Target Start/End: Original strand, 33631514 - 33631650
Alignment:
| Q |
80 |
gtgtgtttgccagcttttagagactatgctatctctagttggctgtattaaatattg--tttgtgtaatttgcagactgttccatttctttgctcttttc |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||| |||||| | ||| ||||||||||| |
|
|
| T |
33631514 |
gtgtgtttgctagcttttagagactatgctatctctagttggctttattaattattgtttttgtgtaatttgcatactgttataattcattgctcttttc |
33631613 |
T |
|
| Q |
178 |
aggtttttcgtactgtcttatcatttggctttctctg |
214 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
33631614 |
tggtttttcatactgtcttatcatttgactttctctg |
33631650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University