View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5208_low_25 (Length: 224)
Name: NF5208_low_25
Description: NF5208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5208_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 2357846 - 2358061
Alignment:
| Q |
1 |
taaatcattaaaagtttctttgctttttgtaactattggtttggatacatgatttttcttacttttttctcgaggatccatttaaacttcatatgaaaaa |
100 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2357846 |
taaatcattataagtttctttgcttgttgtaactatttgtttggatacatgatttttcttacttttttctcgaggatccatttaaacttcatatgaaaaa |
2357945 |
T |
 |
| Q |
101 |
ttataagctttcataatagattgaatgaatgaaaatatcatgcaagagagttaaattaagtgagagagagagtnnnnnnnnaggaggctacaaagaattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2357946 |
ttataagctttcataatagattgaatgaatgaaaatatcatgtaagagagttaaattaagtgagagagaga--tgggggggaggaggctacaaagaattg |
2358043 |
T |
 |
| Q |
201 |
gagaaagagtgaggatgc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2358044 |
gagaaagagtgaggatgc |
2358061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University